Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AD0735
Clone ID AD0735
Vector pGT0lxr
Project sanger

Sequence tag AD0735
Sequence
TTTTTTTTTCTGCAAAGTGGTACGATCGAAGGGACTATGTATTCATTGAATTTTGTGTTGAAGACAGTAAAGATGTTAAT
GTAAACTTTGAAAAATCCAAACTTACTTTCAGTTGTCTTGGAGGAAGCGATAATTTTAAGCATTTAAATGAAATTGATCT
TTTTCATTGTATCGATCCAAATGATTCCAAGCATAAAAGAACAGACAGATCGATTTTATGTTGTTTGCGAAAAGGAGAAT
CCGGCCAGTCATGGCCTAGGTTAACAAAGGAAAGGGCAAAGCTTAATTGGCTCAGTGTGGACTTCAATAATTGGAAAGAC
TGGGAGGATGACTCAGATGAATACTATGTCGAATTTTGACCGTTTCTGTGAGATGATGGATCACATGGGTGGTGATGAGG
ATGTAGATTTACTCAGAAGTAGATGGAGCAGATGAT
Sequence Type mRNA
Unitrap ID UNI4413

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127505737..127511340 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071072 (Ptges3) NM_019766 prostaglandin E synthase 3 (cytosolic) Gene [Source:MGI (curated);Acc:Ptges3-001]

 
Come back to gene ENSMUSG00000071072


For any suggestions or comments, please send an email to unitrap@crg.es