Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST340538
Clone ID OST340538
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST340538
Sequence
TGAAGAACTTCCAGGACATNATGCGAAAGCANAGGCCAGAAAGAGTGTCTCATCTTCTTCAGGATAACTTGCCAAAGTCT
GTTTCTACTTTTCAATATGATCATTTCTTTGAGAAGAAAATTGATGAGAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI21129

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106143612..106144044 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032786 (Alas1) NP_065584 aminolevulinic acid synthase 1 Gene [Source:MGI Symbol;Acc:MGI:87989]

 
Come back to gene ENSMUSG00000032786


For any suggestions or comments, please send an email to unitrap@crg.es