Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AD0429
Clone ID AD0429
Vector pGT0lxr
Project sanger

Sequence tag AD0429
Sequence
GTTGTGATCTATTATATATTGTGGTTGCGAGCTCTTCTAGATGGTGGTTGTGAGCTCTTCTAGATGGTTTTGGAATGTAT
GCTTAAGAAAGACCTCATCTATAATAAGGTCACTCCCACATTTCACCACTGGAAGATCGATGACAAGAAGTTTGGCCTTA
CCTTTCAGAGTCCTGCTGATGCCAGGGCTTTTGATCGAGGCATTCGAAGAGCTATAGAGGATATATCTCTAGGGTGCCCA
GCGTCAAAAAGCTGAGGCTGAAGGAGGAGATGATGATTTACAA
Sequence Type mRNA
Unitrap ID UNI4419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 116989232..116990731 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027351 (Spred1) NM_033524 sprouty protein with EVH-1 domain 1, related sequence Gene [Source:MGI (curated);Acc:Spred1-001]

 
Come back to gene ENSMUSG00000027351


For any suggestions or comments, please send an email to unitrap@crg.es