Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST340137
Clone ID OST340137
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST340137
Sequence
ACTGAGCCCATTGCTATGGACAGTGCCATCACTCTGTGGCAGTTCCTTCTCCAGCTCCTGCAGGAGCCTCAGAATGAGCA
CATGATCTGCTGGACATCTAACNATGGGGAGTTCAAGCTTCTGCAGGCTGGAGGAGGTGGCTCGTCTTTGGGGGATTCGC
AAGAACAAGCCTAATATGAATTATGATAAACTCAGCCGAGCCCTGCGATACTACTACGTAAAGAACATCATTAAAAAAGT
GAATGGTCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI21140

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 133910958..133914198 213
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026436 (Elk4) NM_007923 ELK4, member of ETS oncogene family Gene [Source:MGI Symbol;Acc:MGI:102853]

 
Come back to gene ENSMUSG00000026436


For any suggestions or comments, please send an email to unitrap@crg.es