Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST340101
Clone ID OST340101
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST340101
Sequence
TCTGAGCTATAAAGACTTGAAGTTGCCCTTCCAGTCTAAAGATGGAAAACAGTACCACCACCATTTCTCGGGAGGAGCTT
GAAGAGCTACAAGAAGCGTTTAATAAAATAGGTAAGGTTAAGGAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI21142

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 95696167..95696287 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049493 (Pls1) NM_001033210 plastin 1 (I-isoform) Gene [Source:MGI Symbol;Acc:MGI:104809]

 
Come back to gene ENSMUSG00000049493


For any suggestions or comments, please send an email to unitrap@crg.es