Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AC0796
Clone ID AC0796
Vector pGT0lxr
Project sanger

Sequence tag AC0796
Sequence
CTTTCCGGGGCAGGCGCGTACGGGTCTCGGAGCCGGGTCTCTGNACCGCCCCCTCCGCGCCCGGCACGCCCGGCGCCGCC
TTCCGCGCTGTCCCTGGGCTCGGCCACTGCGAGGTTCCACTCGAGCGCAGCGCCGTAACAAGTGGGCGAGGATGCCGTAC
GAGATCAAGAAGGTGTTCGCCAGCCTCCCCCAGGTGGAGCGGGGCGTCTCTAAGATCCTCGGTGGAGACCCCAAGGGCGA
TCATTTCCTCTACACCAATGGCAAGTGCGTCATCCTAAGAAACATCGAT
Sequence Type mRNA
Unitrap ID UNI1301

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 38952319..38952915 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005103 (Wdr1) NP_035845 WD repeat domain 1 Gene [Source:MGI Symbol;Acc:MGI:1337100]

 
Come back to gene ENSMUSG00000005103


For any suggestions or comments, please send an email to unitrap@crg.es