Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST339958
Clone ID OST339958
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST339958
Sequence
CTCTTACTGTTCTCAGCATNATGANGGTCNCCAGTGGCAGNGCCGNAGCCGNTGCAGCGCCCTAGCATGTTCTNGTGAAN
GCAGGNCAGNACAGCTGGGCGAGGTGGTACTTGGTCTGTCGGAGCAAAGCGTGGCCATCTCGCGCTGCGCTGGGACGCGC
CTGCCCGCCTTGCTGGACGAGCAGCAGGTGAACGTCCTGCTCTACGACATGAACNTTTGCTACTCACGCCTCAAGGAGCT
GGTGCCCACCCTGCCCCAGAACCGCAAAGTGAGCAAGGTGGAGATCCTGCAGCATGTAATCGACTACATCAGGGACCTGC
AGCTGGAGCTGAACTCGGAGTCTGAAGTCGGGACCACCGGAGGCCGGGGACTGCCTGTCCGCGCCCCGCTCAGCACCCTG
AACGGCGAGATCAGTGCCTTGGCGGCCGAGGCGGCATGTGTTCCAGCCGACGATCGCATCTTGTGTCGCTGAGGCGGCGC
ACTGAGGGACCAGATGGTG
Sequence Type mRNA
Unitrap ID UNI20273

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152562063..152562774 375
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042745 (Id1) NM_010495 inhibitor of DNA binding 1 Gene [Source:MGI (curated);Acc:Id1-002]

 
Come back to gene ENSMUSG00000042745


For any suggestions or comments, please send an email to unitrap@crg.es