Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AC0382
Clone ID AC0382
Vector pGT0lxr
Project sanger

Sequence tag AC0382
Sequence
ATCTGATCTATATTGTTTTGGTTTGGATGTGATCTATACGATATTGTTTTGGATGTGATCTATTCGAGATGTTTTTGGTT
GTGAGCTCTTCTAGATGGTCTTTTTCCGCTCCGTGTGAGTGGCACTTGGCGCGGGCTTGCGTTCGGCGCTGGTGTTGGCG
GGGCGCGGAGCATCTCTGCAGGTCGGCTCGCGTCGGGACCATGGCCACCGACTCATGGGCGCTGGCGGTGGACGAGCAGG
AAGCCGCTGTCAAGTCG
Sequence Type mRNA
Unitrap ID UNI4445

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 113521567..113521727 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015023 (Ddx19a) NM_007916 DEAD (Asp-Glu-Ala-Asp) box polypeptide 19a Gene [Source:MGI (curated);Acc:Ddx19a-001]

 
Come back to gene ENSMUSG00000015023


For any suggestions or comments, please send an email to unitrap@crg.es