Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST339253
Clone ID OST339253
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST339253
Sequence
GACTGAGATCGAGTTCCGNGATGAAGCTGAACTTTCTCCTCGGNCCGGGGCAGCAGGGCGGNAGTTGACCCAAGACGAGA
AGCTTCAGCTTCGAAAAGAAAAGAAA
Sequence Type mRNA
Unitrap ID UNI21185

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 31494605..31494997 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029145 (Eif2b4) NM_010122 eukaryotic translation initiation factor 2B, subunit 4 delta Gene [Source:MGI (curated);Acc:Eif2b4-001]

 
Come back to gene ENSMUSG00000029145


For any suggestions or comments, please send an email to unitrap@crg.es