Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST339239
Clone ID OST339239
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST339239
Sequence
TCTGGAATGGACGGANCCTCAGGCGTTCAGCANAGTCAGGGATGGGTCCACGTATATGATCCATGAACCAGAACCTCACA
TCTTACTGTTCCGACGGCCACTGCCCAAGAAGCCAAAGAAATGAAGCCGGCGAACCGCCTTCCGGCCTCGAGCGGTCCAC
AGCTGTCCTCACTCCCTGCCATCTTTCTGATCGCGTGACCATGTTGCTTTCTTATTTCTCACTTTGATATGTAAAGGATA
CACTGTTTGAATGTGCTGGTACCTGCTTTGCTTCTGGAGTTGAGCCACCAGTGCCACAGCCCTGTCAGATGAGTGTGACC
TCAAAGCCCTCGTGTGCGCGGGACCCAGCAGGCCATATTAGTCATTTGGCAGAAGCATGTGAAATCTAGATCATGGCTGT
TACAAGGATGGTGTGAATTTGCTGACGTGTTTTTTACTATTGGGTATTGTATTTATGATGACTTATGGATTTATGTTTCA
ATGTATTGGAAAT
Sequence Type mRNA
Unitrap ID UNI20140

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89219464..89220259 426
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028044 (Cks1b) NM_016904 CDC28 protein kinase 1b Gene [Source:MGI (curated);Acc:Cks1b-001]

 
Come back to gene ENSMUSG00000028044


For any suggestions or comments, please send an email to unitrap@crg.es