Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST339077
Clone ID OST339077
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST339077
Sequence
GACTGAGGGATGATGGNCCCTCTTCCTCAGTCTCAGCACTCAAGCGTCTGGAACGGAGCCAGTGGACAGACANGATGGAC
TTACTGGNTTGGNTTCNAANGGCTGAAAGAGCCTGGAGAAAGGACTGGCTGGCTGATCAACATGCACCCTACTGAGATCT
TAGATGAAGACAAACGCCTTATGTCAGCTCNGGTCGGATTACTACATTCATTCAAGATGATGGAAGCANATTTAAGGTGG
CCTTGCCCTATATGCCGTATTTCTACATTGCAGCGAGAAAGGGTTGTGATCGAGAAGTTTCATCTTTTCTATCCAAGAAG
TTTCAGGGAAAAATTGCAAAGTTAGAGAATGTGCCCAAAGAAGATCTGGACTTGCCAAATCACTTGGTGGGCTTGAAGCG
GAGTTACATCAAGCTGTCCTTCCACACTGTGGAGGACCTTGTCAAAGTGAGAAAGGAGATCTCTCCTGCTGTGAAGAAGA
ACCGAGAGCAGGACCATGCTAGTGATGAGTATACAACAATGCTCTCCAGGTAACTTTCCTTCTCAAGAGCAAAGTGC
Sequence Type mRNA
Unitrap ID UNI21193

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 110718246..110720160 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007080 (Pole) NM_011132 polymerase (DNA directed), epsilon Gene [Source:MGI (curated);Acc:Pole-001]

 
Come back to gene ENSMUSG00000007080


For any suggestions or comments, please send an email to unitrap@crg.es