Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AC0192
Clone ID AC0192
Vector pGT0lxr
Project sanger

Sequence tag AC0192
Sequence
AGAGTCTATAATGAAGTCCCAACTTTCCAGCTAGAGGTTCCTAAAGAGTTTGCTGCAAGTCTGTTGGATTACATAGGCTC
TCAGGCCCAGTACCTCCACACGTTCATGGCCATCACTCATGCTGCAAAAGTGGAGTCGGAGCAACATGGGGACCGCTTAC
CAAGAGTGGAAATGGCTTTGGAGGCTCTGAGAAATGGGATCAAATACAACCCAAGATCGGAAGTGGAGAGCTATCCTACA
AGGGAGGTTAATATTTTCTCTTCTCCGAGTCCATGGAGCTGGTCAAGTGCAGCAGCTGGCGTTAGAG
Sequence Type mRNA
Unitrap ID UNI4448

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 104074851..104078012 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032560 (Dnajc13) DnaJ (Hsp40) homolog, subfamily C, member 13 Gene [Source:MGI Symbol;Acc:MGI:2676368]

 
Come back to gene ENSMUSG00000032560


For any suggestions or comments, please send an email to unitrap@crg.es