Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST338790
Clone ID OST338790
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST338790
Sequence
ATGCTTGAGCGTCTGCTGCNCAGCGGCCGCCGAAGCTGATGCACCAGCGTCATCTTCCAGATTCCTCCCTCCCGACAGAC
ACCTCCTCATCGAGAGGTACTACACCTTTGATGAGGCCTTTGTTCGGGAGGTCTTGGGCAAGAAGCTGTCCAAGGGTACC
AAGAAAGACCTGGATGACATCAGCACCAAAACAGGAATTACTCTCAAGAGCTGCCGGAGGCAGTTTGACAACTTTAAACG
AGTCTTCAAGGTGGTGGAAGAAATGCGGGGCTCCCTGGTGGACAACATCCAGCAGCACTTCCTCCTCTCTGACCGGTTAG
CCAGGGATTACGCAGCCATCGTCTTTTTTGCCAACAACCGCTTTGAAACAGGAAAGAAAAAGCTGCAGTACCTGAGCTTT
GGGGACTTTG
Sequence Type mRNA
Unitrap ID UNI21206

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5461068..5463256 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024911 (Fibp) NP_067413 fibroblast growth factor (acidic) intracellular binding protein Gene [Source:MGI Symbol;Acc:MGI:1926233]

 
Come back to gene ENSMUSG00000024911


For any suggestions or comments, please send an email to unitrap@crg.es