Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST338709
Clone ID OST338709
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST338709
Sequence
CCACACTTATAAACCATAAAGATAATACCAAAAAGTCTGATAAAACCCTGCAAGCGATTCAGCGTGTGGGACAAGCAGTC
AACTTGGCAGTTGGAAGATTTGTTAAAGTAGGGGAAGCTATAGCCAACGAAAACTGGGATTTGAAAGAAGAAATTAACAT
CGCCTGCATCGAAGCCAAGCAAGCAGGTGAAACAATCGCCTCACTCACAGATGTGACTAAACGGAGCCATTTGGAATCAG
ATGGTCAGGTCACGATTCTGACAGACAAAACAGGCGTCGTGCAGGCCGCCCGGCTGCTGCTCTCCTCAGTGACAAAAGTG
CTGCTGCTGGCAGATCGTGTAGTCATCAAGCAGATAGTGACATCGAGANACAAGATTCTCGCAACCATGGAAAGGCTAGA
GAAAGTAAACAGCCTTTCAGGAATTTGTTCAGATATTCAGCCCAGTTTGGAAACGAAATGGTGGAGTT
Sequence Type mRNA
Unitrap ID UNI7146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56854461..56860867 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038816 (Ctnnal1) NM_018761 catenin (cadherin associated protein), alpha-like 1 Gene [Source:MGI (curated);Acc:Ctnnal1-001]

 
Come back to gene ENSMUSG00000038816


For any suggestions or comments, please send an email to unitrap@crg.es