Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AA0320
Clone ID AA0320
Vector pGT0lxr
Project sanger

Sequence tag AA0320
Sequence
AGCAGGCAGATAGAAGCTCCTGTCATCTCTCTACCTTTATGGAGTAGGATGTGAAATGTCTGCTACTGGAAATACCACTC
AGATGTCAGTTGATCATGATGAGTTCCTGCGTGCCTGTACTCCTGGAGCATCTCTGCGGAAAGGAAGAGGGAATTCCTCC
ATGGATAGCACAGCAGGGTGCAGTGGAACCCCACCTATATGCCGACAAGCCCAGACCAAGCTAGAAGTGGCCTTATACAT
GTTTCTGTGGAATCCTGACACTGAAGCTGTTCTGGTTGCTATGTCCTGTTTCCGCCACCTCTGTGAAGAAGCAGATATTC
GATGTGGGGTAGATGAAGTGTCAGTACACAACTTCTTGCCCAACTATAACACATTCATGGAATTTGCCTCAGTCAGCAAT
ATGATGTCAACAGGAAGAGCAGCGCTTCAGAAAAGAGTGATGGCCCTGCTAAGGCGCATTGAGCACCCTACTGCAGGAAA
CATTGAGGCCTGGGAAGATACACATGCAAAGTGGGAACAGGCTACAAAACTAATCCTTAACTACCCAAAAGCCAAAATGG
AAGATGGCCAG
Sequence Type mRNA
Unitrap ID UNI4459

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79252187..79255476 257
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020716 (Nf1) NM_010897 neurofibromatosis 1 Gene [Source:MGI (curated);Acc:Nf1-003]

 
Come back to gene ENSMUSG00000020716


For any suggestions or comments, please send an email to unitrap@crg.es