Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST338180
Clone ID OST338180
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST338180
Sequence
GACTGAGATGTTACCAGGGGNTTCCATGACCCATGCCTTTCTCCTTTAGNGCATGACTTGATNTGTAACCTTGGGTCTGA
ACTCAAAGAAATTTGTGATATCAATAGCATTGTAACTCAAAATGGTGAAGTACCGATGGAAAGCAATTACTGACCGTGTG
AGATATGAAGAATTAGGTTTGTATTCTCTTTGTACATCAAGCTTCCGTTAGTACTGTAACATTAAAAATTTGTTGTGTGG
TTAAA
Sequence Type mRNA
Unitrap ID UNI14595

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15116463..15116702 223
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079709 (AC182749.2-203) NP_001116842 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8C5D3]

 
Come back to gene ENSMUSG00000079709


For any suggestions or comments, please send an email to unitrap@crg.es