Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AA0272
Clone ID AA0272
Vector pGT0lxr
Project sanger

Sequence tag AA0272
Sequence
ACAGGGAATGGAAATGAAGTCTGGTGAGAGATGCTGCTCCTTCGATGGGGATGCGGACAGGATCGTGTATTACTACTGTG
ATGCAGATGGTCACTTTCATCTCATAGATGGAGACAAGATAGCGACGTTAATTAGCAGTTTCCTTAAAGAGCTACTGTTG
GAGATTGGAGAAAGTGTGAACCTCGGAGTCGTACAGACAGCATATGCAAATGGAAGTTCCACGCGGTACCTTGAAGAAGT
TATGAAGGTACCTGTGTATTGCACCAAAACTGGTGTTAAACATTTGCATCACAAGGCTCAAGAGTTTGACATCGGAGTTT
ATTTTGAAGCGAACGGGCATGGAACA
Sequence Type mRNA
Unitrap ID UNI4465

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 86453022..86456301 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056131 (Pgm3) NM_028352 phosphoglucomutase 3 Gene [Source:MGI Symbol;Acc:MGI:97566]

 
Come back to gene ENSMUSG00000056131


For any suggestions or comments, please send an email to unitrap@crg.es