Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST338033
Clone ID OST338033
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST338033
Sequence
ACTGAGCCTGTTCCCTCAAAGTAACCTTCTGGCTACCTTAGAACTAAAATTGGCACTAAAAGCCTAGAGAAGTGAGCAGC
ACGTGAAGATTCAGAGGACAATGTTAGTGTAGAGCCATACAAACAAGAAAAGACAAGTAAACACTACCCAGATCGCACAG
GAAATGGAGCCAGAAACTCCAGAGAAGGTGGATTCTGCACAAGAGAAAGTCAGAGGCAAGACCCCGACAGCAGATGATTC
AGATGACAGCCGAGAAAAGACTGGCATAGAAGAGAAAGGAGAACTGACCGACGCCTATCAGCTGCAGGTAGCTGAAGAAA
TGGCAAAGGAGATCAAGAAGAAAATAAGAAAGAAGCTAANGGAACAGCTGACCTACTTTCCTCCAGACACTCTATTGCAT
GACGACAAGCTGGCCAGTGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI17680

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 20679416..20679841 418
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019986 (Ahi1) NM_026203 Abelson helper integration site 1 Gene [Source:MGI Symbol;Acc:MGI:87971]

 
Come back to gene ENSMUSG00000019986


For any suggestions or comments, please send an email to unitrap@crg.es