Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST337986
Clone ID OST337986
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST337986
Sequence
ACTGAGTTCCTTCTAATGATTCTCAGTCATGCCCGAGTGAAGAAACACAGGAGGAGGATCTGCTGAATAAGTGCATGCAG
TCCATGTCCATCCAAGAACAAGGCCCAGCTCACGCCAGCCTGACGGTCTAGTCCTCCACACCAAGCTCAGCCATCAGCTA
ACATCCACATGCTGAGTGCACAGGGAAGAGTGGACCATGTATGGGATAGTACTAGTAGTAACGGTATGTTATTTTGGTTG
TTGAGAAATTTATAATAGCCGCCTTCGTCTGATATATTTCTGTGTTAATGTGTAATGTATGCTTGTTTCTAGCTAGAACA
ATTAAAATTTTACTTGCAACATAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI21223

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122814589..122814930 342
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029463 (1500011H22Rik) NM_026883 RIKEN cDNA 1500011H22 gene Gene [Source:MGI Symbol;Acc:MGI:1916198]

 
Come back to gene ENSMUSG00000029463


For any suggestions or comments, please send an email to unitrap@crg.es