Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AA0056
Clone ID AA0056
Vector pGT0lxr
Project sanger

Sequence tag AA0056
Sequence
GAAGCAGCTGAAAGAGGTTTTCCCTGTACCCTGCATTTTCGAGTAAGATATTTTATACCTGATCCCAACACAGTGCAGCA
GGAGCAAACCAGGCATCTATATATCTTACAACTGAAGATGGATGTGTTCGAAGGAAGGTTAACCTGCCCTCTCAACTCAG
CGGTGGTTCTAGCCTCGTACGCAGTACAATCTCATTTTGGAGACTTTAATTCTTCCATACATCATCCGGGCTATCTTGCT
GACAGCCAGTTCATACCAGATCAAAATGATGACTTTTTGAGCAAGGTGGAGTCACTCCATGAACAGCACAGTGGGCTAAA
GCAGTCGGAAGCCGAATCTTGCTACATCAACATAGCTCGAACCCTTGACTTCTACGGAGTGGAGCTTCATGGAGGCAGAG
ATCTGCACAACCTAGATCTAATGATCGGGATTGCGTCTGCAGGCATTGCAGTCTACCGAAAATACATTTGCACAAGTTTC
TACCCTTGGGTGAACATACTCAAAATTTCTTTCAAAAGGAAAAAGTTCTTCATACACCAGCGGCAAAAACAG
Sequence Type mRNA
Unitrap ID UNI4472

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57253658..57275384 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038764 (Ptpn3) NP_035337 protein tyrosine phosphatase, non-receptor type 3 Gene [Source:MGI (curated);Acc:Ptpn3-001]

 
Come back to gene ENSMUSG00000038764


For any suggestions or comments, please send an email to unitrap@crg.es