Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AA0046
Clone ID AA0046
Vector pGT0lxr
Project sanger

Sequence tag AA0046
Sequence
TTGTGAGCTTTTCTAGATGGTTTTTTTTGGGGTCAAGAACATTTGAATTGCTTGGCTCTTCTGCATGAATTATTCAATGG
GTATCTTCAGGAGGGAAAGTCTGAAATGCCAGTACCCGAATCAGCACCCCAAATGCCATCTCCAGTGGAAAAGACTCAAG
CTTTTAAAACTGAACAAAGTTCAGATGACCTGCGGACAGGCATCTTTCAGTATGTACAGGACGCTGAATCTTTGAAACTC
CCTGGTGTGTATGAAGTCTTGTTTTATAATGAAACAGAAGAGAGCCCAGGGATGATGTTGTGGAGATATCCAGAACCTCG
AGTGCTCACCCTTGTACGAATCACGCCTGTGCCTTTCAACACCACAGAGGATCCAGATATCAGCACAGCAGACCTGGGTG
ATGTGCTGCAG
Sequence Type mRNA
Unitrap ID UNI4473

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 35723590..35724244 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037646 (Vps13b) vacuolar protein sorting 13B (yeast) Gene [Source:MGI Symbol;Acc:MGI:1916380]

 
Come back to gene ENSMUSG00000037646


For any suggestions or comments, please send an email to unitrap@crg.es