Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AA0042
Clone ID AA0042
Vector pGT0lxr
Project sanger

Sequence tag AA0042
Sequence
GGCAGAGACTCATGTAGCACAGGCTGCCCTTGCCCATTTCAGTCGTTGAAGAGCGTCTTGCTTCTGTCTCCTCATTGCTG
GGACTAAAGGTGACCACCACCATGTTCAGGTCCAACAGCTGCAGATCTTGCTGCTACAAGCCCATGGAGGCACCTTGCCT
GGAGATATAAATGTGGAACCATCAGAAAATCTTCAGTCCCTGATGGAGAAGAATCAGTCTCTGGTGGAAGAGAATGAAAA
ATTAAGTCGTGGTCTGAGTGAGGCAGCTGGTCAAACAGCCCAGATGCTGGAGAGGATCATTCTGACAGAGCAAGCAAATG
AGAAAATGAATGCCAAGCTAGAAGAACTCAGGCGGCATGCGGCCTGTAAAGTGGATCTTCAAAAGCTCGTGGAGACATTG
GAAGACCAGGAGTTAAAAGAAAACATAGAGATAATTTGCAACCTACAACAAGTGATTGCCCAGCTATCT
Sequence Type mRNA
Unitrap ID UNI4474

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 97862718..97875453 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034311 (Kif4) NM_008446 kinesin family member 4 Gene [Source:MGI (curated);Acc:Kif4-001]

 
Come back to gene ENSMUSG00000034311


For any suggestions or comments, please send an email to unitrap@crg.es