Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AA0024
Clone ID AA0024
Vector pGT0lxr
Project sanger

Sequence tag AA0024
Sequence
GAACAGGAACCTTGTGGATGGTGGCTGGCCCGGGTGCAGATGATGAAGGGAGATTTTATGTCATTGAGTACGCTGCCTGT
GATGCTACCTACAATGAGATTGTCACTCTGGAAAGACTTCGGCCAGTCAATCCCAGTCCCCTTGCAACCAAAGGCAGCTT
CTTCAAGGTTACCATGGCTGTGCCTGAGGACATCAGGGAGGCCTGCTCCAANGAAAATGTCCANAAGGAGACCAAGAAAG
CACCGGGAGCCAACNGCANCNNNCNCAACANCTGGTTGTGAGCTCTTCTAGATGGTTTTTTTTTAATGGGATAGGTTACG
TTGGTGTAGATGGGCGCAGTAGGCGGCGGCAGCAGGGGGAGGTGGAGGCCGTGGAGCGGCAGCGGCAATGAAGAAGCTAT
TAAGCACCTAGAGACAAGTAAGCAGATGGCAGCAGCCTTCCAAGAGGAGTTCACAGTGCGAGAGGACATGATGGGTCTGG
CGATCGGAACGCACGGTGCCAACATCCAGCAGGCTCGGAAAGTGCCCGGAGTGACTGCCACTGAGTTGGGTGAAGAGACC
CGCACTTTCTGAATCTATGGGGAG
Sequence Type mRNA
Unitrap ID UNI4476

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69454802..69462477 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018765 (Fxr2) NM_011814 fragile X mental retardation, autosomal homolog 2 Gene [Source:MGI (curated);Acc:Fxr2-006]

 
Come back to gene ENSMUSG00000018765


For any suggestions or comments, please send an email to unitrap@crg.es