Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST337144
Clone ID OST337144
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST337144
Sequence
CCTTGTTCAACAGTCATGCAACTACAAGCAGCTTCGGAAAGGAGCCAATGAANCCACCAAAACCCTCAACAGAGGCATCT
CTGAGTTCATTGTGATGGCAGCAGACGCTGAGCCCTTGGAGATCATCCTGCACCTCCCTCTGCTGTGCGAAGACAAGAAT
GTCCCCTACGTATTTGTGCGCTCCAAGCAGGCTTTAGGACGGGCGTGTGGCGTCTCCAGGCCAGTCATCGCCTGTTCTGT
TACCATCAAAGAAGGCTCTCAACTAAAGCAGCAGATCCAGTCCATTCAGCAGTCTATTGAAAGGCTCTTGGTGTAGGCTG
TGGCCTCTGCCCTTTCCTGTCTACTGCCACCCTGTTTGTGTATCATATTGTCTGTTAGC
Sequence Type mRNA
Unitrap ID UNI10855

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81872473..81874379 326
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063480 (AC102176.8-201) NM_011482 NHP2-like protein 1 (High mobility group-like nuclear protein 2 homolog 1)(U4/U6.U5 tri-snRNP 15.5 kDa protein)(Sperm-specific antigen 1)(Fertilization antigen 1)(FA-1) [Source:UniProtKB/Swiss-Prot;Acc:Q9D0T1]

 
Come back to gene ENSMUSG00000063480


For any suggestions or comments, please send an email to unitrap@crg.es