Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AH0519
Clone ID AH0519
Vector pGT0lxr
Project sanger

Sequence tag AH0519
Sequence
ACGCGGAACCCGGCGCGGCGGCGGCGGCGGCGGCGGCGGCGGCAAGATGGTCATGGCGCATTTCGTGGAGAATTTCTGG
Sequence Type mRNA
Unitrap ID UNI4478

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 99585031..99585109 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041685 (Fcho2) NP_766179 FCH domain only 2 Gene [Source:MGI Symbol;Acc:MGI:3505790]

 
Come back to gene ENSMUSG00000041685


For any suggestions or comments, please send an email to unitrap@crg.es