Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CA0248
Clone ID CA0248
Vector pGT0lxf*
Project sanger

Sequence tag CA0248
Sequence
CTTTCTTAGGAGTCTTTAGTGAGTGCTGCGAGGGTAAATCAGGCAAGATCAGAACTTCAGACATGGTCCCAAATCCCGAA
AACCTAAGAAGAAGAA
Sequence Type mRNA
Unitrap ID UNI2288

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177660262..177660328 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074529 (C330013J21Rik) RIKEN cDNA C330013J21 gene Gene [Source:MGI Symbol;Acc:MGI:1925953]

 
Come back to gene ENSMUSG00000074529


For any suggestions or comments, please send an email to unitrap@crg.es