Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CA0213
Clone ID CA0213
Vector pGT0lxf*
Project sanger

Sequence tag CA0213
Sequence
TTTTTTGGTTGGAATTTTTTTAAAGGGGTTTTTTTTTTTTTCTTTTCTTTTTGGTTCGCCCTAAAGGTACCAATATGGCG
GAGGCTTCCTTTGGAAGTTCGAGCCCAGTTGGGTCTTTGTCTTCTGAGGACCATGACTTTGACCCCACTGCTGAGATGCT
AGTTCATGACTATGATGATGAAAGAACTCTAGAGGAAGAAGAGTTGATGGACGCCGAAGAGAGCTTCAGCTCTGAAATTG
AAGACTTAGAGA
Sequence Type mRNA
Unitrap ID UNI1777

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 112476533..112481587 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032727 (Mier3) NP_766181 mesoderm induction early response 1, family member 3 Gene [Source:MGI (curated);Acc:Mier3-001]

 
Come back to gene ENSMUSG00000032727


For any suggestions or comments, please send an email to unitrap@crg.es