Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XT0496
Clone ID XT0496
Vector pGT0lxf
Project sanger

Sequence tag XT0496
Sequence
TTTGGGAAAGCAGCAGCACCAGATCCAAGATGGCGGCCAGCAGGAGGCTGATGAAGGAGCTTGAAGAGATCCGCAAATGT
GGAATGAAAAACTTCCGTAACATCCAGGTTGATGAAGCTAATTTATTGACTTGGCAAGGGCTTATTGTTCCT
Sequence Type mRNA
Unitrap ID UNI4483

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17176505..17201583 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038965 (Ube2l3) NM_009456 ubiquitin-conjugating enzyme E2L 3 Gene [Source:MGI (curated);Acc:Ube2l3-001]

 
Come back to gene ENSMUSG00000038965


For any suggestions or comments, please send an email to unitrap@crg.es