Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST336263
Clone ID OST336263
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST336263
Sequence
GACTGAGGCCTGTTCCTCCACCATCGGCTCTGCAGCCAGCAGACTCTGATTTCTTCCCTGCTTCCATATCCCTTCCCGGG
CTGGAGCCTCCTGGTGGACCCGACCTCCTGGACGATGGCTTTGCCTATGATCCTTCTGCCCCCACGCTCTTCACTATGTT
GGACCTGCTGCCCCCAGCACCACCACTTGCCAGTGCTGTGGTGGGTAGCCGGGGGTGCAGGGGCCACCGTTGTGGAGTCT
TCTGGCCCAGAGCCCCTGTCACTGGACTCTTTTGCAGCGCCGGGCCCCGGGGGATGTTGGTACTGCTAGCCTTGTGGGCA
GCAACATGTTTCCCAACCAGTACCGAGAGGCAGCTTTCGGGGGTGGCCTCCTATCTCCAGGGCCTGAAGCCACGTAGCCT
CTGAGGTAACAGAGGAGGCACTGGGTGAGGTATGTGGTATAGCACTCCATTCCGAAGCCAACCTTGATCAGNCTTCCAGC
TTCCTCATCCTGAATCGGACATCTGCAGCGCTGG
Sequence Type mRNA
Unitrap ID UNI15951

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20191785..20192292 488
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002983 (Relb) NM_009046 avian reticuloendotheliosis viral (v-rel) oncogene related B Gene [Source:MGI (curated);Acc:Relb-001]

 
Come back to gene ENSMUSG00000002983


For any suggestions or comments, please send an email to unitrap@crg.es