Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST335974
Clone ID OST335974
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST335974
Sequence
CATATTATAACCATTCCAAAGTGTGCTAGGTGATGATTTTATTAAGTCCAGTGATAGGAAAGACTGGGAACACTCAAGAC
ATTTATTTAGTAAAACAGTGCTCTGTCCTAGAGGGTTAAGGCACATGTGGTAATTAAAAAACTCAAAGGCTCAAAAAAAA
AAA
Sequence Type mRNA
Unitrap ID UNI14558

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5851218..5851372 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043488 (AC142098.2) Putative uncharacterized protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q8CEY4]

 
Come back to gene ENSMUSG00000043488


For any suggestions or comments, please send an email to unitrap@crg.es