Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AS0371
Clone ID AS0371
Vector pGT0lxr
Project sanger

Sequence tag AS0371
Sequence
CTTTTTGATCTTCCCTTTTATGCAGTCAACAATTCTATATACCACGTTTGATGAAATACTGGCAAAACACATAGAGTGAT
GGTAGCATGAACCAGCTTCCTTGTTTCCTTGGAGAGCCT
Sequence Type mRNA
Unitrap ID UNI1957

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15125862..15125924 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079709 (AC182749.2-203) NP_001116842 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8C5D3]

 
Come back to gene ENSMUSG00000079709


For any suggestions or comments, please send an email to unitrap@crg.es