Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST334464
Clone ID OST334464
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST334464
Sequence
TCGACGATTTCAAAAGATCCCTAATGTTGAAAATGAGACAATGATCCCTGTACTGACGTCAAAGAGAGCAAGTGAGTTAG
CAGTCAGTGAGGTTGCAGGCCTTCTCCAGGCTGATCTTCAGAATGGCTTAAACAAATCTGAAGTTAGTCATAGGCGAGCC
TTCCATGGTTGGAATGAATTTGATATCAGTGAAGATGAACCATTATGGAAGAAGTATATTTCTCAGTTTAAAAATCCCCT
TATCATGCTGCTCCTGGCGTCTGCGGTCATCAGCATTTTAATGCGCCAGTTTGATGATGCCGTCAGTATCACTGTGGCAA
TAGTAATTGTCCGTCACCGTGGCCTTTGTTCAGGAATATCGTTCAGAAAAATCTCTAGAAGAATTGAGTAAACTTGTGCC
ACCAGAGTGCCATTGTGTGCGTGAAGGAAAACCTGGAGCATACACTTGCCCGAGANTTGGTTCCAGGTGACACAGTTTGT
CTNTCTGTGGCGAACAGAGTTCCTGCGGA
Sequence Type mRNA
Unitrap ID UNI19956

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 105362006..105372472 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032570 (Atp2c1) NM_175025 ATPase, Ca++-sequestering Gene [Source:MGI Symbol;Acc:MGI:1889008]

 
Come back to gene ENSMUSG00000032570


For any suggestions or comments, please send an email to unitrap@crg.es