Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST334295
Clone ID OST334295
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST334295
Sequence
AACTGAGGACAACAGCCGCAGACAGAAGCAACTGTTAAACCAGAGGTTCGAGACCCTGTGCGCGGTTTTGGAGGAGCGCA
AGGGCGAACTGCTTCAAGCACTGGCCCGGGAGCAGGAGGAGAAGTTGCAGCGCGTGCGGGGCCTCATCCGCCAGTACGGA
GACCACTTGGAGGGCTCCTCAAAGCTGGTGGAGTCCGCCATCCAGTCCATGGAGGAGCCGCAGATGGCTCTCTACCTCCA
GCAGGCAAAGGAGCTGATCAACAAGGTCGGGGCAATGTCGAAGGTGGAGCTGGCAGGACGGCCGGAGCCAGGCTATGAGA
GCATGGAGCAATTCTCTGTGAGCGTGGAGCACGTGGCCGAAATGTTGCGAACCATCGACTTCCAGCCGGGCGCCGCTGGG
GATGAAGAGGATGACGACATGGCTTTGGATGGGGAGGAGGGCAATGCGGGGCTGGAGGAGGAGCGGCTGGACGTGCCAGA
AGGCTCAGGCCTGCACTGACCCGACTCTGATCCAGA
Sequence Type mRNA
Unitrap ID UNI21322

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 31438414..31439883 236
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062077 (Trim54) NM_021447 tripartite motif-containing 54 Gene [Source:MGI (curated);Acc:Trim54-001]

 
Come back to gene ENSMUSG00000062077


For any suggestions or comments, please send an email to unitrap@crg.es