Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST334137
Clone ID OST334137
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST334137
Sequence
GACTGAGAGGAGACTTTGACTGGCCAGCCGCCTGCATTGAGCTGGAGCAGCACCTGGCCCGCTGGGCAGAGGATGGACTG
CGAACCGAGTACTTCTGCCTGGCTGATGGCCACTTTGCTTCCATTGATGCGGTGTTGCTGCTCCAGGGTGGGGCACTGTG
TCTGTCAGGCATCCCGGGATCAGAAATGTCAACCTGTGGGACCTGCGCCATCTAGGGAAGGATCCCAGCCGAGTTCTGGT
GAAGGCCTTAGGCACCCAGGGCAATAGCACACACAAGGGCATGGGTATGGTCGCTAGCAGCGCAGGACCACCGTGTGTGC
TCCGGCTCTTGGGACAGCACTGTGAAGCTGTGGGACATGGCGGCTGATGGGCAGCAGTTTGGAGAGATCAAGGGCAAGGC
GGCANNGCTGNGCCTTTCCTACCNACCTGATATCCTGGTGACTGGTACCTATGACAAGAAGGCGACCATCTATGATCCCA
GAGCTGGCTTGCCCCTGNTGAAAAACCGGAGGCTGCACTCAAGCGCGGTGCTANCAGTGCTGGCAGATGACAG
Sequence Type mRNA
Unitrap ID UNI21331

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87585843..87589789 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008167 (Fbxw9) NM_026791 F-box and WD-40 domain protein 9 Gene [Source:MGI (curated);Acc:Fbxw9-001]

 
Come back to gene ENSMUSG00000008167


For any suggestions or comments, please send an email to unitrap@crg.es