Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AM1178
Clone ID AM1178
Vector pGT0lxr
Project sanger

Sequence tag AM1178
Sequence
CTCATGCCTCTCTGGCTACCGATCCGGGTGTGGGTACTTTTAGCCAGCGGCCGCTGTCATGACGACCCAGGGGGGCCTAG
TGGCCAACCGAGGCCGGCGGTTCAAATGGGCCATTGAGCTGAGTGGGCCGGGAGGAGGCAGCAGGGGCCGAAGTGACCGG
GGCAGTGGACAGGGAGACTCCCTCTATCCAGTCGGTTACTTGGACAAGCA
Sequence Type mRNA
Unitrap ID UNI4498

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 112207608..112208094 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027131 (Tmem85) NM_026519 transmembrane protein 85 Gene [Source:MGI (curated);Acc:Tmem85-001]

 
Come back to gene ENSMUSG00000027131


For any suggestions or comments, please send an email to unitrap@crg.es