Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST333854
Clone ID OST333854
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST333854
Sequence
GAAGATGCTGTTGTGGAAGCAACTTCCAGCGATGCTGTGAGGTTTTACCCCTGGACCATCGATAACAAGTACTATTCCGC
AGAGATCAACCTGTGCGTGGTGCCAAGCAAGTTCCTGGTCACTGCTGAGATTGCCGAGTCAGTCCAGGCGTTTGTAGTTT
ACTTTGACAGCACACAGAAATCAGGTCTTGACAGCGTCTCCTCGTGGCTCCCTCTGGCAGAAGCATGGCTAGCTGAGGTG
ATGATCCTGGTCTGTGATAGAGTGTGTGACGATGGAATAAACCGACAACAGGCTCAAGAGTGGTGCATCAAACATGGCCT
TTGAGTTGGTGGAACTCAACCCAGAGGAGCTGCCCGAGGAGGACGATGACTTCCCTGAATCTACAGGANGTANAGCNGAT
TGTACAAGCATTGAATGCCAATGTCTG
Sequence Type mRNA
Unitrap ID UNI6355

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 63464507..63467015 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037257 (2310007F21Rik) NM_025857 RIKEN cDNA 2310007F21 gene Gene [Source:MGI Symbol;Acc:MGI:1914189]

 
Come back to gene ENSMUSG00000037257


For any suggestions or comments, please send an email to unitrap@crg.es