Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST333828
Clone ID OST333828
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST333828
Sequence
TTTTCCGAATTCAAAGATGGTGAAGCTAGATATTCACACATTGGCCCACCACCTCAAGCAGGANCGCTTATATGTGAGCT
CTGAGAAACAGCATCATTCAGAGGCTNAATGCCGATGTACTGNAGACAGCTGAAAAGCTGTATCAGAACAGCGTGGATTG
CAAAGCAACAGAGGATTAATTTGGATCGTCTTATTATAACCAGNGCTGAAGCTTCCCCTGCTGAGTGTTGCCAGCATGCC
AAGATTTTGGAAGATACACAGTTTGTTGATGGATATAAGCAACNTGGGATTTCAGGAAACAGCTTATGGAGAATTCCTGA
GTCGGTTAAGAGAAAATCCACGACTTATTGCCTCCTCTTTGGTTGNTGGAGAAAANCTCANTCNGGAGAACACACAAAGT
GTTATCTACACTGTTTTTACCTCCTTGTATGGCAACTGTNTTATGCNANGAAGATGAAAGCTACCTCCTTCA
Sequence Type mRNA
Unitrap ID UNI20563

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 34584428..34586183 252
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026867 (Gapvd1) NM_025709 GTPase activating protein and VPS9 domains 1 Gene [Source:MGI (curated);Acc:Gapvd1-001]

 
Come back to gene ENSMUSG00000026867


For any suggestions or comments, please send an email to unitrap@crg.es