Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST333789
Clone ID OST333789
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST333789
Sequence
GAGGGGGATGCTGCCCCGCCCCCCACAGGAGATGCCTTCCAACTCACTGTGGAAGGAGAAGCTCCGCACCCCGAGGATCC
CAAGCTCCTGTCTGAGCAGGGTCCTGCTACTTCCGTGACTGACTATAGGAGTCTGATTCCCTCAGATGAGGAGGTAACAC
TGCCGGAGGATGAGGAGTCTGGCCAGGCCAGGGTCCGGGCGAGGCACACCCCTAGGCCTGCACAGTCGGTGCTGTCAGAC
GGGATTTCGCAGTCTTCCCGGCGGCCCTCTAAGTTCCGCCGAAGTATGACTGGCATCCCAAACCTCCAGGAGACCCTC
Sequence Type mRNA
Unitrap ID UNI21347

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 30772449..30772766 318
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033826 (Dnahc8) NM_013811 dynein, axonemal, heavy chain 8 Gene [Source:MGI Symbol;Acc:MGI:107714]

 
Come back to gene ENSMUSG00000033826


For any suggestions or comments, please send an email to unitrap@crg.es