Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST333737
Clone ID OST333737
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST333737
Sequence
ACTGAGCGGCAGGTGCTCTACCTGCCTCCCCTGCAGCAGGTGTTTCAGGCACCCCGCCGGCCTGGCATTGGCACTGTGGG
CAAACCAATCANGCTTCTGGCCAATTACTTTGAGGTGGACATTCCTAAGATTGACNGTTTACCATTACGAGGTGGACATC
AAGCCGGATAAGTGTCCTCGCAGAGTCAACCGGGAGGTGGTGGAATACATGGTCCAGCATTTCAAACCGCAGATCTTTGG
GGATCGCAAGCCTGTGTATGATGGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI10652

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 126138969..126141101 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041530 (Eif2c1) NM_153403 eukaryotic translation initiation factor 2C, 1 Gene [Source:MGI (curated);Acc:Eif2c1-001]

 
Come back to gene ENSMUSG00000041530


For any suggestions or comments, please send an email to unitrap@crg.es