Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AC0051
Clone ID AC0051
Vector pGT0lxr
Project sanger

Sequence tag AC0051
Sequence
GTACCCGGGCTGGGCAGGGGTGCCACTGGCTTCACCACCCGATCAGACATCGGGCCTGCTCGGGATGCAAATGATCCTGT
GGATGATCGCCATGCCCCACCAGGGAAGAGAACTGTGGGGGACCAGATGAAGAAAAATCAGGCGGCTGATGATGATGATG
AAGATCTGAATGATACCAACTACGATGAG
Sequence Type mRNA
Unitrap ID UNI4503

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181336217..181342993 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002455 (Prpf6) NM_133701 PRP6 pre-mRNA splicing factor 6 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1922946]

 
Come back to gene ENSMUSG00000002455


For any suggestions or comments, please send an email to unitrap@crg.es