Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST332857
Clone ID OST332857
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST332857
Sequence
ATTGAGAAGAACTGTGCCATNCATAGCATGGTTGTTAGGAATCGATCCCGCGAGGCCCGGAAGGACCGAACACCCCCACC
ACGATTCAGACCTGCTGGCGCTGCACCTCGACCTCCACCAAAGCCCATGTAAAGAGGCCGTTTTGTAAGGACGGAAGGAA
AATTACCCTGGAAAAATAAAATGGAAGTTGT
Sequence Type mRNA
Unitrap ID UNI86

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 128061598..128062350 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025362 (AC117232.3) NM_013765 40S ribosomal protein S26 [Source:UniProtKB/Swiss-Prot;Acc:P62855]

 
Come back to gene ENSMUSG00000025362


For any suggestions or comments, please send an email to unitrap@crg.es