Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST332639
Clone ID OST332639
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST332639
Sequence
TGAGCCTGAACCAGAGGATCACTCAGNGTGCTCCAGTGAAGCAGCCCCCACCCTTGGCTCCCCAGAGCCCACAGGGAGGC
GTCCTGGGTGGAGGCAGTTCCAACCAGCAGCAGCAAATACAGCTGCAGCAGTTACAGATGGAGAAGGAGAGACTGCGGTT
GAAACAACAGGAATTATTTCGGCAGGCAATACGGGAATATCAATCCCAGCACAGCAAATGCTCCAAAATGTCAGGAATTA
GCTCTGCGCAGCCAGTTGCCTACACTGGAGCAGGATGGAGGGACTCCGAATGCAGTGTCTTCTCCTGGGATGTCTCAGGA
ATTGAGAACANTGACAACCAATAGTTCCGATCCCTTTCTTAACAGTGGCACCTATCACTCTCGAGATGAGAGCACAGACA
GCGGCCTCAGCATGAGACAGCTTCCATAGAAATATATTAATTATTACCACATACTCTAAGAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI5357

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7936572..7953136 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053110 (Yap1) NM_009534 yes-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:103262]

 
Come back to gene ENSMUSG00000053110


For any suggestions or comments, please send an email to unitrap@crg.es