Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST332612
Clone ID OST332612
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST332612
Sequence
CGGTATGCCACCAAGCCGAGCCACTGGTGCATNGTGGCGTACTGTGAGCACCGGACACGCNTGGGCCGCCTCTATGCNGT
GTACGACCAGGCTGTCAGCATCTTCTACGACCTACCTCAGGGCAGCGGCTTCTGCCTGGGCCAGCTCAACCTGGAGCAGC
GCAGTGAGTCGGTGCNGGCGCACGCNGCAGCAAGATCGGTTTTGGCATACTGCTCAGCAAGGAGCCAGACGGCGTGTGGG
CCTACAACCGGGGCAGAGCACCCCATCTTCGTCAACTCCCCGACGCTGGATGCGCCCGGAGGCCGCGCCCTGGTCGTGCG
CAAGGTGCCACCGGGTTACTCCATCAAGGTGTTCGACTTTGAGCGCTCAGGGCTGCTGCAGCACGCAGACGCCGCTCACG
GCCCCTACGACCCGCACAGTGTGCGCATCAGCTTCGCCAAGGGCTGGGGACCCTGCTACTCACGACAGTTCATCACCTCC
TGCCCCTGTTGGCTGGAGATCCTACTCAACAACCACAGATAGCAATGCGGCTG
Sequence Type mRNA
Unitrap ID UNI17237

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 63801320..63801845 503
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036867 (Smad6) NM_008542 MAD homolog 6 (Drosophila) Gene [Source:MGI (curated);Acc:Smad6-001]

 
Come back to gene ENSMUSG00000036867


For any suggestions or comments, please send an email to unitrap@crg.es