Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST332445
Clone ID OST332445
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST332445
Sequence
ACTGAGGGTGTGGAGAGAGCACGTGATCGCATTGTGGGTTTCCCTGGCCGGTACCATGCGTGGGACATACCACACCAGTC
CTGGCTCTACAATTCCAACTACTCCTGTGAGCTGTCCATGGTGCTGACGGGCGCTGCCTTCTTTCACAAGTATTATGCCT
ACCTGTATTCTTATGTGATGCCCCAGGCCATCCGGGACATGGTGGACGAGTACATCAACTGTGAGGATATCGCCATGAAC
TTCCTTGTCTCCCACATCACACGGAAACCCCCCATCAAGGTGACATCAAGGTGGACTTTTCGATGCCCAGGGTGCCCTCA
GGCCCTGTCCCATGATGACTCTCATTTTCACGAGCGGCACAAGTGTATCAACTTTTTTGTCAAGGTGTACGGCTATATGC
CTCTCTTGTACACACAGTTCAGGGTGGACTCCGTGCTCTTCAAGACCCGCCTGCCCCATGACAAGACCAAGTGCTTCAAG
TTCATCTAGGGCCTTGCCAGTTCTGAGGAGACGATGAGCAGAGCGAGGGGAGTCACCCTCAAGGTTCCCAT
Sequence Type mRNA
Unitrap ID UNI21389

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 65673389..65677968 274
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021978 (Extl3) NM_018788 exostoses (multiple)-like 3 Gene [Source:MGI Symbol;Acc:MGI:1860765]

 
Come back to gene ENSMUSG00000021978


For any suggestions or comments, please send an email to unitrap@crg.es