Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST331934
Clone ID OST331934
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST331934
Sequence
ACACTCTGATAGGTACNGACAGGNCGCGTGAACACAGNGGGGATTCCTATCTGAGTCCATTGGGGCTGTGCCCAACAATA
CTTGAAGAGCCACAGTGGTCTCCCTGCCGACCTGGTGCTGGCCCACTGGAACTTTATTTATTTCTGTTTCCTCGTCTATG
CCTCCCTGAGGACTCTGCAGGGGGCTTTTGAATGACACCCTGGCCTGAGCCTGGGAAACTTGGATGCTGGTCAGGGCTCT
CTTTCCCCTGCAAAGGACCCAACTAAGCACTTAGCAGTTTGCCATGGCCTTCCCAGCATCCCCTGAGGCTAAAGTTCCAC
CAAGACCGTCGATATCGACGAGGGACATTTCCAAACGGACCTCCCCATCTTCATTTGGCCTCCTGAGAAGCCACCTCAGG
AGCTGAGGCTAAGCACTAAGCCCAGGACCATATGACTAGGGCACTGTACGCCCCGCCCCTAGTTAGAGGGTAGGTTTTGG
ACTTGGCTGGGTGTGGTCAT
Sequence Type mRNA
Unitrap ID UNI10692

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 140884407..140884878 464
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006445 (Epha2) NM_010139 Eph receptor A2 Gene [Source:MGI (curated);Acc:Epha2-001]

 
Come back to gene ENSMUSG00000006445


For any suggestions or comments, please send an email to unitrap@crg.es