Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AG0228
Clone ID AG0228
Vector pGT0lxr
Project sanger

Sequence tag AG0228
Sequence
CATGTAAGATGGCGCCCAGGGAGCTGTGAGGAGAAAATCCTGTCGGTCTCGGAGCGGCGACGGCAGAACCGAGGCCCCGG
GCGGTGAATCGGGGCCGGCGGGTAGAACGGAGGCAGCGGCGGCGGTGACGTCGCCGG
Sequence Type mRNA
Unitrap ID UNI1575

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108419436..108419571 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006673 (Qrich1) NP_001107591 glutamine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1916482]

 
Come back to gene ENSMUSG00000006673


For any suggestions or comments, please send an email to unitrap@crg.es