Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST331139
Clone ID OST331139
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST331139
Sequence
CTGAGGTTCCGGAGGCTTCTTCTCAGGNCTCATACTCCTTTCAGAGCTGCTGCCTCTTCCCTTGCCCATGCAGACCACGC
AGAATTTGCAAATTAGATCGCTTCATCAATGGACTCTGCTCAACTGACTGCCAACCTGAGAACAATACTTTTTTTTAGAC
CTGTTGGATTCAAACAATTGTTTAATTGTAATAGTGTAATAGTGAATTATGTTTTAAGCATGCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI21419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 11454207..11454703 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040720 (1110037F02Rik) NM_001081183 RIKEN cDNA 1110037F02 gene Gene [Source:MGI Symbol;Acc:MGI:1913435]

 
Come back to gene ENSMUSG00000040720


For any suggestions or comments, please send an email to unitrap@crg.es