Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST330183
Clone ID OST330183
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST330183
Sequence
GACTGAGGCTAAGGAAATTTTAACGAAAGATCAAATGTGCAAGAGGTCCGCTGTCCTGTTACCGTCTGTGGAGATGTGCA
TGGCCAATTCCATGACCTTATGGAGCTCTTCAGAATTGGTGGGAAATCACCAGATACGAACTACCTATTCATGGGGGACT
ATGTAGACAGAGGCTACTACTCTGTGGAGACTGTGACTCTTCTTGTAGCGTTAAAGGTGCGCTATCCAGAGCGCATCACA
ATATTGCGAGGAAATCACGAAAGCCGGCAGATCACACAAGTGTATGGCTTTTATGATGAGTGCCTACGGAAGTATGGAAA
TGCCAACGTGTGGAAATACTTTACAGATCTCTTTGATTATCTTCCACTTACAGCTTTAGTAGATGGACAGATATTCTGCC
TCCACGGTGGCCTGTCTCCATCCATAGATACACTGGACCACATAAGAGCCCTGGATCGCTTGCAAGAAGTTCCACATGAG
GGCCCAATGTGTGATCTCTTATGGTCAGATCCGGATGACCGTGGCGGCTGGGGTAA
Sequence Type mRNA
Unitrap ID UNI21327

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 34721125..34726190 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009630 (Ppp2cb) NM_017374 protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform Gene [Source:MGI Symbol;Acc:MGI:1321161]

 
Come back to gene ENSMUSG00000009630


For any suggestions or comments, please send an email to unitrap@crg.es