Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST330022
Clone ID OST330022
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST330022
Sequence
GACTGAGGGCGACAGTTGCTACGATTTCAGGAAGATCTGATCTCCTCTGCTGTGGCTGAATTGAATTATGGCCTTTGTTT
AATGACACGAGAAGCTCGGAATGGAGAAGGTGAACCCTATGACCCAGATGTACTCTACTACATTTTCCTGTGTATACAGA
AGTATCTTTTTGAAAATGGAAGAGTAGATGACATATTTTCTGATCTTTACTATGTTCGTTTCACCGAATGGCTACATGAA
GTTCTGAAGGATGTACAGCCTCGGGTCACTCCACTTGGCTATGTGTTGCCCAGTCACGTGACTGAAGAGATGCTGTGGGA
ATGTAAGCAGCTTGGGGCACATTCCCCTTCCACACTGCTGACCACCCTCATGTTCTTTAACACCAAGTACTTCCTGTTGA
AGACTGTAGATCAGCACATGAAGCTGGCTTTCTCTAAGGTCCTCCGACAGACAAAGAAGAGCCCCTCGAATCCTAAGGAT
AAAAGCACGAGCATCCGCTACCTGAAGGCCCTCGGAATACACCAG
Sequence Type mRNA
Unitrap ID UNI21441

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108444761..108458877 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006673 (Qrich1) NP_001107591 glutamine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1916482]

 
Come back to gene ENSMUSG00000006673


For any suggestions or comments, please send an email to unitrap@crg.es