Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST329816
Clone ID OST329816
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST329816
Sequence
GAGTTGGAAAATGGATATACTTTATTTGACTACGACGTTGGACTGAATGATATAATTCAGCTGCTAGTTCGTCCAGACTC
CAGTCTTCCTAGCACATCTAAGCAGAATGATGCTCAGGTTAAACCCTCTTCTCATAATCCGCCTAAAGTAAAGAAAACAG
CAAGAGGGGGATCTTCCAGTCAGCCATCTACATCAGCTCGCACNTTGTCTTATTGACCCTGGCTTTGGACTATATAAGGT
AAATGAATTGGTGGATGCCAGAGATGTCGGCCTTGGTGCTTGGTTTGAAGCACATATACATAGTGTTACTAGAGCTTCTG
ATGGACATTCACGTGGCAAAACTCCACTGAAGAATGGCAGTTCTTATAAAAGGACTAATGGAAATGTAAATCATAATTCC
AAAGAGAACACAAATAAATTGGACAATGTACCCTCTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI21455

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 30113552..30130923 236
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024817 (Uhrf2) NM_144873 ubiquitin-like, containing PHD and RING finger domains 2 Gene [Source:MGI (curated);Acc:Uhrf2-001]

 
Come back to gene ENSMUSG00000024817


For any suggestions or comments, please send an email to unitrap@crg.es